متفرقات

رهوديولا أمابيليس

رهوديولا أمابيليس


الاسم العلمي

رهوديولا أمابيليس (هـ. أوبا) ح

المرادفات

سيدوم امابيل

التصنيف العلمي

عائلة: كراسولاسيا
جنس: رهوديولا

وصف

رهوديولا أمابيليس هو نبات عصاري جميل دائم الخضرة ، يصل ارتفاعه إلى 4 بوصات (10 سم) ، ويشكل رنبًا غير محكم مع ذرة مركزية متفرعة. الأوراق خضراء زاهية ، بيضاوية الشكل ، يصل طولها إلى 0.3 بوصة (7 مم) ومرتبة في ريدات. يصل طول سيقان الزهور إلى 2 بوصة (5 سم) ، وتحمل واحدة إلى بضع زهور بيضاء يصل عرضها إلى 0.8 بوصة (2 سم).

كيف ينمو ويهتم

عند النمو سيدوم، لا تنسى سيدوم النباتات تحتاج القليل من الاهتمام أو الرعاية. سوف تزدهر في الظروف التي تزدهر فيها العديد من النباتات الأخرى ، ولكنها ستعمل أيضًا في المناطق الأقل ضيافة. إنها مثالية لهذا الجزء من الفناء الخاص بك الذي يتعرض للكثير من أشعة الشمس أو القليل جدًا من الماء لزراعة أي شيء آخر. اسم شائع لـ سيدوم هو Stonecrop ، نظرًا لحقيقة أن العديد من البستانيين يمزحون أن الحجارة فقط تحتاج إلى رعاية أقل وتعيش لفترة أطول.

سيدوم يتم زرعها بسهولة. بالنسبة للأصناف الأقصر ، فإن مجرد وضع النبات على الأرض حيث تريد أن ينمو يكون كافيًا للحصول على سيدوم بدأ المصنع هناك. سيرسلون الجذور من أي مكان يلامس فيه الجذع الأرض ويجذر نفسه. إذا كنت ترغب في التأكد من أن النبات سيبدأ هناك ، يمكنك إضافة غطاء رقيق جدًا من التربة فوق النبات. لأطول سيدوم يمكنك قطع أحد السيقان ودفعه إلى الأرض حيث ترغب في زراعته. ستجذر الساق بسهولة شديدة وسيتم إنشاء نبتة جديدة في موسم أو موسمين ... - شاهد المزيد في: كيفية النمو والعناية بجمال الأزهار الجميلة.

أصل

موطنها نيبال وكشمير.

الروابط

العودة إلى جنس رهوديولا
SUCCULENTOPEDIA: تصفح العصارة حسب الجنس أو العائلة أو الاسم العلمي أو الاسم الشائع أو الأصل أو الصبار حسب الجنس

معرض الصور


اشترك الآن وكن على اطلاع بآخر الأخبار والتحديثات.





الطرق والنتائج

الجدول 1.

التنوع الجيني في ثمانية رهوديولا السكان على أساس 17 موقعًا للأقمار الصناعية الصغيرة. أ

مكانR. crenulataص. ساكراR. fastigiataر
RC1 (ن = 24)RC2 (ن = 24)RS1 (ن = 24)RS2 (ن = 24)RF1 (ن = 24)RF2 (ن = 24)RB1 (ن = 24)RB2 (ن = 24)
أحاحهFأحاحهFأحاحهFأحاحهFأحاحهFأحاحهFأحاحهFأحاحهF
روبية 130.8750.518 * −0.68840.4290.480 * 0.10630.0420.119 * 0.6520.0430.043−0.0221400.238 * 1500.361 * 1200.080 * 1
روبية 270.750.747−0.00350.7080.699 * −0.01450.2080.2620.20550.2170.4930.559410.576 * −0.73540.6090.472−0.29150.2080.194−0.07160.50.587 * 0.148
روبية 380.3040.737 * 0.58790.1110.867 * 0.872300.156 * 130.0830.594 * 0.8630.2080.536 * 0.61180.2080.609 * 0.658110.0420.829 * 0.95100.1670.847 * 0.803
روبية 4100.8330.757 * −0.101120.6670.8220.18950.3330.359 * 0.0750.8750.683 * −0.28150.750.635 * −0.18270.9170.752 * −0.219120.2920.661 * 0.55950.2080.497 * 0.581
5 روبية200.091 * 11200.5160.1110.753 * 0.85270.5710.709 * 0.19450.30.665 * 0.54930.3330.542 * 0.385300.500 * 1
روبية 640.10.685 * 0.85480.10.804 * 0.87630.0430.124 * 0.64980.0590.839 * 0.9340.050.414 * 0.87950.870.681 * −0.276110.1250.891 * 0.86600.813 * 1
روبية 730.50.5460.08440.1670.594 * 0.71930.0420.119 * 0.6540.4780.585 * 0.18330.0830.081−0.03240.4170.677 * 0.38520.1250.2490.49830.3330.601 * 0.445
روبية 860.0910.645 * 0.85990.3330.734 * 0.546400.358 * 190.250.593 * 0.57870.1670.444 * 0.62480.3040.660 * 0.53980.2270.826 * 0.72550.0830.298 * 0.72
9 روبية200.278111200.153 * 1400.691 * 1200.198 * 1400.475 * 1300.480 * 1
10 روبية70.3330.4790.30430.0870.084−0.03480.4580.4840.05280.750.753 * 0.00350.8330.633 * −0.31760.7920.678−0.16850.6960.513−0.355110.5830.803 * 0.274
11 روبية90.750.8280.09490.5830.849 * 0.31380.5420.804 * 0.32690.9170.661 * −0.38690.4580.857 * 0.46570.1670.578 * 0.71270.2080.658 * 0.68350.0420.296 * 0.859
12 روبية30.1670.352 * 0.52640.2080.381 * 0.45330.1250.442 * 0.71740.5420.610.11280.250.505 * 0.50590.0830.566 * 0.85350.2920.4640.37180.2080.679 * 0.693
13 روبية40.1250.2890.56890.4290.705 * 0.39290.750.746−0.00640.7920.553 * −0.43290.6670.780 * 0.14690.4550.689 * 0.3440.0870.306 * 0.716120.3910.758 * 0.484
14 روبية20.0830.08−0.04370.4170.772 * 0.4650.3330.580 * 0.42540.7080.644−0.140.6670.568−0.17470.50.710.29640.4580.6070.24580.4580.713 * 0.357
15 روبية20.0420.041−0.02130.1250.414 * 0.69820.0420.041−0.02120.4580.353−0.29730.7920.588 * −0.34730.0830.258 * 0.67730.1670.2580.35440.130.271 * 0.519
16 روبية30.0870.1620.46250.0450.650 * 0.93300.405 * 130.4350.5530.21440.250.659 * 0.6240.1110.539 * 0.79430.050.141 * 0.64630.0950.177 * 0.462
17 روبية70.0480.804 * 0.94170.050.786 * 0.93670.0950.680 * 0.86400.525 * 180.250.723 * 0.65480.3640.851 * 0.57370.1110.821 * 0.865120.5450.8930.389
يعني4.8240.2990.4730.3785.8820.2620.5670.4384.3530.1770.3630.5054.8240.3950.5520.2815.1760.4120.5530.235.8820.3630.5780.4375.8240.2010.5170.5556.2350.220.5470.631

ملحوظة: أ = متوسط ​​عدد الأليلات لكل موضع F = مؤشر التثبيت حه = تغاير الزيجوت المتوقع حا = تغاير الزيجوت الملحوظ ن = حجم العينة.

تم تصنيع أزواج التمهيدي لـ 66 تسلسلًا للأقمار الصناعية الصغيرة تحتوي على منطقة تكرار من 20 إلى 24 قاعدة وتم فحصها مبدئيًا باستخدام أربع عينات من كل منها رهوديولا محيط. بعد تحسين PCR ، بما في ذلك التدرج PCR لاختبار درجة حرارة التلدين وتغيير نسبة الكواشف ، ولّد 17 (25.8٪) من هذه المواقع نطاقات ثابتة وواضحة مع درجات حرارة تلدين مستقلة (الجدول 2). ثم تم اختبار 17 موقعًا باستخدام 192 عينة من الحمض النووي من مجموعتين لكل منهما رهوديولا الأنواع (الجدول 1). تم إجراء تضخمات التحسين في حجم نهائي قدره 10 ميكرولتر ، بما في ذلك ∼20 نانوغرام من الحمض النووي الجيني ، 6.5 ميكرولتر من الماء المقطر المزدوج ، 1 ميكرولتر 10 × طق عازلة التفاعل ، 0.8 ميكرولتر dNTP ، 0.8 ميكرولتر Mg 2+ ، 0.25 ميكرولتر من البادئات الأمامية ، 0.25 ميكرولتر التمهيدي العكسي ، و 0.05 ميكرولتر 0.5 U / ميكرولتر طق بوليميراز الحمض النووي. تم استخدام جهاز تدوير حراري Biometra مع ظروف ركوب الدراجات التالية: 94 درجة مئوية لمدة 5 دقائق و 35 دورة عند 94 درجة مئوية لمدة 40 ثانية ، 55-57.8 درجة مئوية (يعتمد على العلامة ، انظر الجدول 1) لمدة 30 ثانية ، و 72 درجة مئوية لمدة 40 ثانية s وخطوة استطالة نهائية قدرها 72 درجة مئوية لمدة 10 دقائق. تم فصل منتجات تفاعل البوليميراز المتسلسل (PCR) على جهاز وراثي رحلان كهربائي شعري (ماجوربيو بيو فارم ، شنغهاي ، الصين). تم فحص أجزاء SSR المنفصلة وتسجيلها باستخدام الإصدار 3.7 من GeneMapper (النظم الحيوية التطبيقية). تم حساب المقاييس الوراثية السكانية القياسية باستخدام GenAlEx 6.4 (Peakall and Smouse ، 2006).

الجدول 2.

تم تطوير خصائص 17 بادئة للأقمار الصناعية الصغيرة في رهوديولا.

مكانتسلسلات التمهيدي (5′ – 3)كرر الفكرةتيأ (درجة مئوية)حجم الأليل (بي بي)انضمام GenBank لا.
روبية 1F: تججكجاتتجتتكككتجت(TGA)355181–223 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857096"، "term_id": "383511661"، "term_text": "JQ857096" >> JQ857096
R: تكاكككتكاتكتككتكا
روبية 2F: جكاكجاتجاكاتتاتاكجا(TCC)455134–224 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857092"، "term_id": "383511657"، "term_text": "JQ857092" >> JQ857092
R: GGTAGGGTTTGAGGTGAC
روبية 3F: تككااتااجككاتككتك(CAA)455183–288 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857095"، "term_id": "383511660"، "term_text": "JQ857095" >> JQ857095
R: TGTGCAACTGTAACCATCGA
روبية 4F: أككتكاتكتجتكككتكا(CT)855119–150 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857089"، "term_id": "383511654"، "term_text": "JQ857089" >> JQ857089
R: كاكككتتتكتجتككككتك
5 روبيةF: جاجاجاجاكتككاتت(CCT)455163–239 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857082"، "term_id": "383511647"، "term_text": "JQ857082" >> JQ857082
R: جتجتجتجاتتجكتتجات
روبية 6F: جاجتكاجتجتجاجاجات(AGG)455157–262 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857094"، "term_id": "383511659"، "term_text": "JQ857094" >> JQ857094
R: CAAAAGATTAGAAACTCAAACG
روبية 7F: تجتجاكتتجتججاكتك(GTT)557.8262–277 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857087"، "term_id": "383511652"، "term_text": "JQ857087" >> JQ857087
R: TGGATAAATTGCTGCCTGAC
روبية 8F: CTGACGCTGAAGCAGTTGAT(TGC)557.8131–206 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857085"، "term_id": "383511650"، "term_text": "JQ857085" >> JQ857085
R: CCCAATGAGGACCGATGAT
9 روبيةF: كتككاتكاتتاكاتكتجكتك(CCT)655177–204 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857084"، "term_id": "383511649"، "term_text": "JQ857084" >> JQ857084
R: TTTTGTTACTTGACTGTGGC
10 روبيةF: TGCGTCAAACGGATCAAACC(CAG)455117–186 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857088"، "term_id": "383511653"، "term_text": "JQ857088" >> JQ857088
R: تكجكتكاجكككتكتكتكات
11 روبيةF: GTTGTTGCTTAGGCTGCTGT(جي سي تي)455265–313 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857097"، "term_id": "383511662"، "term_text": "JQ857097" >> JQ857097
R: AACTTCTATGGAAATGTGGC
12 روبيةF: AAAAGACAGTATAGCCTCACC(TCA)455112–148 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857091"، "term_id": "383511656"، "term_text": "JQ857091" >> JQ857091
R: تجتاجاكتجاتجكتجكتجات
13 روبيةF: GAATAAGGTGCTGGAGGTT(GGA)555156–234 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857089"، "term_id": "383511654"، "term_text": "JQ857089" >> JQ857089
ر: جاتجاغاكاجاتجاغ
14 روبيةF: كاجاجكجاتككتكاتكا(AGG)455140–200 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857083"، "term_id": "383511648"، "term_text": "JQ857083" >> JQ857083
R: CGAATCACCCGTAACCCTAA
15 روبيةF: CCACAGAAGCGAGTCAGGTT(GCATCA)555146–164 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857090"، "term_id": "383511655"، "term_text": "JQ857090" >> JQ857090
R: GTCCCGGCAAATACAAAGT
16 روبيةF: آكاجكاجتكجاجاا(GCA)455116–173 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857086"، "term_id": "383511651"، "term_text": "JQ857086" >> JQ857086
R: CATCTTGAACCCTAATCCA
17 روبيةF: أتكتكاتكتكاجككجتكك(GA)855126–310 <"type": "entrez-nucleotide"، "attrs": <"text": "JQ857093"، "term_id": "383511658"، "term_text": "JQ857093" >> JQ857093
R: CACAGCCATTAGCCAACT

ملحوظة: تيأ = درجة حرارة التلدين المثلى.

عبر جميع السكان من الأربعة رهوديولا الأنواع ، عدد الأليلات لكل موضع متعدد الأشكال (أ) من واحد إلى 12 (الجدول 1). بالنسبة للمواقع متعددة الأشكال ، فإن متوسط ​​قيم الملاحظة (حا) وتوقع تغاير الزيجوت (حه) من 0.177 إلى 0.412 ومن 0.363 إلى 0.578 على التوالي. مؤشر التثبيت (F) متغيرًا بدرجة كبيرة بين المواقع في كل مجموعة (الجدول 1) متوسط ​​عبر المواقع لكل نوع ، وتراوح من 0.230 إلى 0.631 ، وهو ما يتوافق مع نظام التزاوج المختلط في رهوديولا. من بين 17 موقعًا تم تحليلها ، أظهر ثمانية إلى 16 موقعًا انحرافًا كبيرًا عن توازن هاردي واينبرغ بناءً على اختبار Bonferroni المتسلسل (الجدول 1) وقد يعكس هذا وجود أليلات فارغة غير مكتشفة أو خروجًا عن ظروف التوازن لسكان مثاليين.


حديقة متوسطة الحجم بها بيوت بلاستيكية. معظم النباتات في أصص ، وبعض الأواني في أحواض مرتفعة. قصاصات مجانية.

بواسطة appt واليوم المفتوح الرسمي.

NC on Wansbeck Estate ، Stakeford ، على بعد 3.2 كم من A189 ، و 4.8 كم من A1.

    يسمح للكلاب في مواقف السيارات المرطبات الخفيفة WC

شركاؤنا

الحفاظ على تنوع نباتات الحدائق

معلومات عنا

الحفاظ على

مجموعات النباتات الوطنية

كيف يمكنك المساعدة؟

الأحداث

المجموعات المحلية

التراث النباتي ، 12 Home Farm ، Loseley Park ، Guildford ، Surrey GU3 1HS | هاتف: 01483 447540

© تراث النبات 2021. ريج. جمعية خيرية رقم 1004009 / SCO41785. شركة ريج رقم 2222953

يستخدم هذا الموقع ملفات تعريف الارتباط لضمان حصولك على أفضل تجربة على موقعنا. اقرأ أكثر


شاهد الفيديو: Rhodiola الروديولا فوائد ومعلومات عشبة